Видео

Lewis Dorothy Davis Sharon Martin Charles

good explanation thanks

Wilson Daniel Davis Ronald Williams James

Jackson Michael Brown Ruth Rodriguez Anthony

Jackson Lisa Johnson Sharon Martin Timothy

Harvey Landing

Taylor Helen Williams Paul Allen Robert

Stephanie Unions

Toni Curve

thank you very much. this is so helpful and very clear to understand easily

Block Stravenue

Bartoletti Curve

Roob Squares

Frieda Row

Javier Lane

Loyal Manors

Martin Nancy Rodriguez Carol Davis Brenda

Wintheiser Squares

Koepp Dale

Good... 👍 Nicely explain ed

Ernser Island

Lavern Roads

Borer Orchard

Rohan Highway

Brakus Stravenue

Paucek Drive

Brown Joseph Robinson Margaret Clark Maria

O'Hara Drive

Johnson Joseph Thomas David Thompson Karen

Kristofer Village

Clovis Track

Hall Gary Moore Shirley Young Maria

Smith Kimberly Moore Michelle Clark Matthew

Mathias Square

Lopez Nancy Young Mary Brown Daniel

Lewis Laura Thomas Sandra Harris Michelle

Lopez Edward Taylor Christopher Davis Timothy

great

Clark Jennifer Harris Carol Brown William

Young Patricia Garcia Carol Harris Michael

Thomas Gary Martin Christopher Miller Ronald

excellent description!

If you still don't believe in a creator at this point, you're a moron

I bought a wgs and the VCF file company supplied is missing a lot of SNP's that are critical and common. I asked the company that how come if they're doing 30x sequencing of 100% of DNA these common SNP's are missing, they told me that it's normal. Is there any way to check the BAM file to figure out if they made mistakes while converting BAM to VCF?

Well done, bt still i have doubt!!! So if uploated vcf file in yfull and after that i upload da bam wht is da advantages??

Excellent information! Could You explain Epigenetics in an other video and tell what test You would consider for that?

SAM File Structure: Header Section: Optional, starts with '@', contains metadata about the sequence and the alignments. Alignment Section: Contains alignment information with each line representing a read. Columns in SAM: QNAME: Query template name. FLAG: Bitwise flag. RNAME: Reference sequence name. POS: 1-based leftmost mapping position. MAPQ: Mapping quality. CIGAR: CIGAR string. RNEXT: Reference name of the mate/next read. PNEXT: Position of the mate/next read. TLEN: Observed template length. SEQ: Segment sequence. QUAL: ASCII of Phred-scaled base quality+33.

@SEQ_ID GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAACTGAGGGTGATGCAG + !''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65

.FASTQ (Raw Sequence Data) FASTQ is a text-based format for storing both nucleotide sequences and their corresponding quality scores. It is widely used in high-throughput sequencing. File Structure: Header Line: Starts with '@' followed by a sequence identifier. Sequence Line: Contains the nucleotide sequence. Plus Line: Starts with a '+' and may be followed by the same sequence identifier. Quality Line: Contains quality scores for each nucleotide in the sequence, encoded as ASCII characters

Hi Katherine, At this time is it possible to use whole geneome sequencing & whole ecome sequencing in combination at present (5-24)?Your presentation was wonderful on many levels~~thank you!!