![Katharine ME](/img/default-banner.jpg)
- Видео 8
- Просмотров 120 051
Katharine ME
США
Добавлен 2 дек 2016
Cofounder @ Guardiome.
How DNA Microarrays Work Using a Simple Example
00:00 Intro
00:05 Basic Description
01:15 Simple Example
03:27 Summary
00:05 Basic Description
01:15 Simple Example
03:27 Summary
Просмотров: 1 714
Видео
Which DNA test is best? Whole Genome Sequencing, Whole Exome Sequencing, and Genotyping - EXPLAINED
Просмотров 14 тыс.2 года назад
Trying to decide on what kind of DNA test to get? Confused over the many consumer offerings and about what your doctor is telling you? This video contains everything you need to know. Here I compare whole genome sequencing, whole exome sequencing, and genotyping on: how much of the genome they cover, how they work, their cost, and what they can tell us. 00:00 Intro 00:30 Genomics review 01:55 G...
FASTQ, BAM, and VCF file formats easily explained - A must watch if you have had a DNA test
Просмотров 15 тыс.2 года назад
FASTQ file format, BAM file format, SAM file format, and VCF file format explained simply for a person with no scientific or technical background. If you have had a DNA test, this video is a must watch for you. You do not need to let your precious genome files sit untouched and unused on a hard drive. This is the first video in a series where I will help you understand and make use of these fil...
DNA Sample Collection Methods - the BEST and the WORST
Просмотров 4,1 тыс.2 года назад
A must watch before you order a DNA test! Here I compare three methods for DNA collection: blood, cheek swab, and saliva. Each are commonly used in the clinic and for consumer DNA tests, but they are not created equal! Learn about the pros and cons of each. 00:00 Intro 00:29 What makes a great DNA sample 02:53 BLOOD 04:16 SWAB 05:53 SALIVA 07:25 Conclusion 07:30 Which method companies use
VCF File Format Explained | General Structure & Columns
Просмотров 13 тыс.3 года назад
This video is a great starting point or review of the VCF file format. Its evolving so be sure to check Samtools' hts-specs repository for the latest: github.com/samtools/hts-specs You may recognize this video in the IGV channel's VCF Basics video, and thats because I made the IGV VCF Basics video, as well as all the other IGV videos currently on that channel.
QTL Analysis Explanation and Example
Просмотров 71 тыс.7 лет назад
In this video I describe how QTL Analysis (Quantitative Trait Loci Analysis) works and give an example of how it could be used to study a particular trait. QTL mapping QTL analysis Quantitative Trait Loci Analysis
Lewis Dorothy Davis Sharon Martin Charles
good explanation thanks
Wilson Daniel Davis Ronald Williams James
Jackson Michael Brown Ruth Rodriguez Anthony
Jackson Lisa Johnson Sharon Martin Timothy
Harvey Landing
Taylor Helen Williams Paul Allen Robert
Stephanie Unions
Toni Curve
thank you very much. this is so helpful and very clear to understand easily
Block Stravenue
Bartoletti Curve
Roob Squares
Frieda Row
Javier Lane
Loyal Manors
Martin Nancy Rodriguez Carol Davis Brenda
Wintheiser Squares
Koepp Dale
Good... 👍 Nicely explain ed
Ernser Island
Lavern Roads
Borer Orchard
Rohan Highway
Brakus Stravenue
Paucek Drive
Brown Joseph Robinson Margaret Clark Maria
O'Hara Drive
Johnson Joseph Thomas David Thompson Karen
Kristofer Village
Clovis Track
Hall Gary Moore Shirley Young Maria
Smith Kimberly Moore Michelle Clark Matthew
Mathias Square
Lopez Nancy Young Mary Brown Daniel
Lewis Laura Thomas Sandra Harris Michelle
Lopez Edward Taylor Christopher Davis Timothy
great
Clark Jennifer Harris Carol Brown William
Young Patricia Garcia Carol Harris Michael
Thomas Gary Martin Christopher Miller Ronald
excellent description!
If you still don't believe in a creator at this point, you're a moron
I bought a wgs and the VCF file company supplied is missing a lot of SNP's that are critical and common. I asked the company that how come if they're doing 30x sequencing of 100% of DNA these common SNP's are missing, they told me that it's normal. Is there any way to check the BAM file to figure out if they made mistakes while converting BAM to VCF?
Well done, bt still i have doubt!!! So if uploated vcf file in yfull and after that i upload da bam wht is da advantages??
Excellent information! Could You explain Epigenetics in an other video and tell what test You would consider for that?
SAM File Structure: Header Section: Optional, starts with '@', contains metadata about the sequence and the alignments. Alignment Section: Contains alignment information with each line representing a read. Columns in SAM: QNAME: Query template name. FLAG: Bitwise flag. RNAME: Reference sequence name. POS: 1-based leftmost mapping position. MAPQ: Mapping quality. CIGAR: CIGAR string. RNEXT: Reference name of the mate/next read. PNEXT: Position of the mate/next read. TLEN: Observed template length. SEQ: Segment sequence. QUAL: ASCII of Phred-scaled base quality+33.
@SEQ_ID GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAACTGAGGGTGATGCAG + !''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65
.FASTQ (Raw Sequence Data) FASTQ is a text-based format for storing both nucleotide sequences and their corresponding quality scores. It is widely used in high-throughput sequencing. File Structure: Header Line: Starts with '@' followed by a sequence identifier. Sequence Line: Contains the nucleotide sequence. Plus Line: Starts with a '+' and may be followed by the same sequence identifier. Quality Line: Contains quality scores for each nucleotide in the sequence, encoded as ASCII characters
Hi Katherine, At this time is it possible to use whole geneome sequencing & whole ecome sequencing in combination at present (5-24)?Your presentation was wonderful on many levels~~thank you!!
Hi JC, yes it is possible. The whole exome has sequence data on the coding regions only (2% of genome) while whole genome obviously has sequence data on the whole genome. So the exome data is kind of a subset of the genome data. But you could use them together to increase confidence of variant calls in coding regions. Does that make sense?
Thanks so much for a great answer😅 Katherine